DNA Analysis Lab

DNA Analysis

Goals

• Examine crime scene evidence
• Model the process of DNA fingerprinting

 

 

Introduction

            DNA fingerprinting has become an acceptable technique when analyzing evidence in criminal investigations, paternity cases, and victim identification in the case of disasters.  The technique is based on the fact that each individual has a unique DNA sequence.  There are several DNA sequences that are the same in people and even animals since we use similar processes such as cellular respiration.  However, everyone has variable DNA sequences in non-coding regions that differ, resulting in individual DNA fingerprints.  The more these regions are probed, the more specific the DNA fingerprint is. 

            DNA fingerprinting involved a series of techniques that result in a pattern of DNA that looks similar to a bar code, which can be used for DNA analysis.  The first step requires isolation and purification of a DNA sample.  However, DNA that is isolated is useless until it is analyzed in some way.  In this lab, you are going to stimulate the steps of DNA fingerprinting to analyze the “DNA sample.”  A crime has occurred and you must identify the culprit!

 

 

The Crime

            The sophomore class had developed a flawless recipe for Super Chocolate Brownies.  They were entering the recipe along with samples to the school brownie competition.  The competition was the final event in the school’s spirit week, and this year it was the tie-breaking event!  But when one of the sophomores walked to her classroom after lunch, she was shocked to see crime scene tape covering the door.  When she looked into the room, she saw investigators huddled around the brownie pan, and the recipe had vanished!  Who could have done such a thing?

 

 

The Evidence - POLICE REPORT

The following crime scene report was turned in by the investigation team.

 

Basic Information

Illegal action: Theft

Complaint status: Pending DNA results

Property involved: Super Chocolate Brownies and Recipe

Value: Spirit week trophy … Incalculable

 

Crime Scene Data

The brownies had been placed on Mrs. B’s desk, the classroom teacher, to cool during lunch to be taken to the competition later in the day.  Mrs. B reported the crime after she returned to the classroom and found the recipe missing … and the brownies eaten.  There was not forced entry into the classroom from outside the building, and the classroom door had been left open.  The investigative team dusted for fingerprints but the room was wiped clean.  Mr. Steel, the school custodian, was questioned and claimed to have cleaned the classroom during lunch.  He had observed several students come by the classroom during lunch.  The classroom was combed for evidence by the forensics unit.  A team jacket with hairs attached to the collar was found near the desk.  The forensics technician said a saliva sample could be taken from the half-eaten brownies that were left behind. 

 

Suspect Data

The microscope examination of the hairs, the presence of the coat, and visual observations of the classroom led to circumstantial evidence pointing to 4 suspects that could have been involved in the crime.

 

SUSPECT 1:

Name: Stan Steel

Occupation: Custodian

Circumstantial evidence: Stan was in charge of cleaning the classrooms.  He had access to the brownies.

 

SUSPECT 2:

Name: Chip Lee

Occupation: student

Circumstantial evidence: Chip was seen entering the classroom by Mr. Steel. He is known for his love of brownies (especially those with chocolate chips).

 

SUSPECT 3:

Name: Brock Lee

Occupation: student

Circumstantial evidence:  Brock is Chip’s twin brother and plans to open a chocolate shop after graduation.  He would love to get his hands on the Super Chocolate Brownie Recipe. 

 

SUSPECT 4:

Name: Jim Sox

Occupation: team captain of the senior class

Circumstantial evidence: Jim had vowed that the senior class would win the spirit week competition. He had all the seniors wear their jackets to show team spirit. 

 

 

Forensics Lab Results

Evidence from the crime scene:  Evidence bag with remaining brownie pieces, evidence bag with the hairs from the coat, cheek swabs from the four suspects

Techniques to be used:  DNA isolation, DNA fingerprinting

 

 

DNA Analysis

1. DNA was isolated from the hair samples, saliva samples, and cheek cell samples from each of the suspects. DNA sequenced for each of the samples are listed below.

 

2. The next step is to cut the DNA with restriction enzymes.

• • Restriction enzymes used in this step cut DNA at the same specific site every time. Why is this essential for the procedure?  Answer in Question 1 below
  • The restriction enzyme you are using cuts at the sequence ATTA. It always cuts between the T’s.  Draw a line through each cut site in the sequence shown below.  

3. Count the number of base pairs in each of the fragments you have created in your DNA strands. Record the fragment lengths under the samples. 

 

Saliva DNA sample:

ATGTAGACTGGACCATATTACGATTAGGCACTCATTAGCCGTACAGTACTCACC

Fragment lengths:  Answer in Question 2 below

 

Hair DNA sample:

ATCTCGTGACATTACCTTGTATCGATTAGCAATTAAGGATCCTGCAGTAGCACC

Fragment lengths:  Answer in Question 3 below

 

Suspect 1 DNA sample:

ATTAACGGGTATCTTCGGATTACGGAGACTAAGTGCCTAGATTACGAAGCTACC

Fragment lengths:  Answer in Question 4 below

 

Suspect 2 DNA sample:

ATCAGCATGTGTTCAATTAGCCGAGATTAAGGCCACTGGAGTACTACGGCCACC

Fragment lengths:  Answer in Question 5 below

 

Suspect 3 DNA sample:

ATGTAGACTGGACCATATTACGATTAGGCACTCATTAGCCGTACAGTACTCACC

Fragment DNA lengths:  Answer in Question 6 below

 

Suspect 4 DNA sample:

ATCTCGTGACATTACCTTGTATCGATTAGCAATTAAGGATCCTGCAGTAGCACC

Fragment lengths:  Answer in Question 7 below

 

4. The DNA fragments are sorted by loading each sample of DNA into the well of a gel. An electric current moves the negatively charged DNA fragments toward the positive end of the gel, sorting them by size with the smaller pieces moving the farthest.  This creates a unique pattern, or DNA fingerprint.  Sort the DNA fragments and draw them in the gel box by their fragment length.  

DNA fragments are placed in the top of the tray.  Electricity moves the DNA fragments through the gel.  The shorter fragments move further.  A line has been placed where the DNA segments stopped for each sample. 

Compare the DNA below, what do you see? Answer in Question 8 below

Gel Box - The DNA segments start here
	Saliva	Hair	Suspect 1	Suspect 2	Suspect 3	Suspect 4
30
29
28
27				----------
26
25
24
23
22			----------
21		----------				----------
20
19	----------				----------
18	----------		----------		----------
17				----------
16
15
14		----------				----------
13
12		----------	----------			----------
11	----------				----------
10				----------
9
8
7		----------				----------
6	----------				----------
5
4
3
2			----------
1

 

5. The next step is to transfer the DNA to a nylon sheet or filter paper and incubate it with the radioactive probes. Explain why this step is essential in DNA fingerprinting.  Answer in Question 9 below

 

6. The final step is to analyze the fingerprints of the suspects and the crime scene evidence. 

 

The Analysis

1. According to the DNA evidence, who committed the crime? Answer in Question 10 below

 

2. How do you know this person committed the crime? Answer in Question 11 below

 

3. Using the DNA evidence, explain how DNA fingerprinting can be used to clear a person as a suspect even through the circumstantial evidence placed him at the scene of the crime. Answer in Questions 12 below

 

4. Why was Suspect 2’s DNA fingerprint not identical to Suspect 3’s DNA fingerprint, although they are identical twins? Answer in Question 13 below

 

5. What are some limitations to using this technique as evidence in a trial? Answer in Question 14 below